An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT145797.1

General info


NONCODE TRANSCRIPT IDNONHSAT145797.1
NONCODE Gene IDNONHSAG020907.1
Chromosomechr17
Start Site15164331
End Site15169024
Strand+
Exon Number2
CNCI Score-0.0735187
Length373
Assemblyhg19
Other transcript VersionsNONHSAT145797.2

Sequence


>NONHSAT145797.1
AAAACAAGCGGTTCGCACGTCTAAAACCACCCAGGGAACGGAGGGGTTTCCAGAAAATATGAGCAGAGGCCACTGCACGCTTCCACCCACCCCAAGCACCTCCCGGCGACCTCCCTGGAAGAATACAATAATCCCAAGAGGCCCTGCAGGGCATGGAGAAACTGGAATCAGAAGGGAGAAGAGCTTTGAGTATGCCTGAAGCCTGTGATGCCAAGACTGTTCTCTCTGGAAGTGCCAACCTGTGTAATAGCCAAGAGGTCCCACTGGCTCCCCTCCCCTCCCAGTGAATTCTGCAGAGATTAAATATACTGTGGGAAGGATCTGTGTCTACAGTGTTACATACGTGCAGGTAAGTTTTATTTTAAATAAACTT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT145796.1

Data Sources

Source NameOld Id
gencodeENST00000579159.1
PMID26117828PNCT_HSA046838
NONCODEv4NONHSAT145797
lncipedialnc-ZNF286A-4-1_dup1
ensemblENST00000579159