An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT145797.2

General info


NONCODE TRANSCRIPT IDNONHSAT145797.2
NONCODE Gene IDNONHSAG020907.2
Chromosomechr17
Start Site15261014
End Site15265707
Strand+
Exon Number2
CNCI Score-0.0286720
Length373
Assemblyhg38
Other transcript VersionsNONHSAT145797.1(old version)

Sequence


>NONHSAT145797.2
AAAACAAGCGGTTCGCACGTCTAAAACCACCCAGGGAACGGAGGGGTTTCCAGAAAATATGAGCAGAGGCCACTGCACGCTTCCACCCACCCCAAGCACCTCCCGGCGACCTCCCTGGAAGAATACAATAATCCCAAGAGGCCCTGCAGGGCATGGAGAAACTGGAATCAGAAGGGAGAAGAGCTTTGAGTATGCCTGAAGCCTGTGATGCCAAGACTGTTCTCTCTGGAAGTGCCAACCTGTGTAATAGCCAAGAGGTCCCACTGGCTCCCCTCCCCTCCCAGTGAATTCTGCAGAGATTAAATATACTGTGGGAAGGATCTGTGTCTACAGTGTTACATACGTGCAGGTAAGTTTTATTTTAAATAAACTT

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
02.40364e-101.94579e-10000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
4.26679e-1000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00.7306038.6964709.97276
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
8.8199008.586980
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset