An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT146050.1

General info


NONCODE TRANSCRIPT IDNONHSAT146050.1
NONCODE Gene IDNONHSAG020996.1
Chromosomechr17
Start Site17071259
End Site17088868
Strand-
Exon Number2
CNCI Score-0.0268462
Length1231
Assemblyhg19
Other transcript VersionsNONHSAT146050.2

Sequence


>NONHSAT146050.1
GCAAGATTTAATAAAAAACAAACAAAAATAGGAATGGTTGCTTTCAACATTTTCCAGGTTGTGAAAGGTTTTGACTGATTTGGGGAAAGAATGGTGAAAAAGAGCTTCTCAGTTCTCCTGAGGTGCTCGCTGACAACCACACCTGTGTGTCTGGGTGGGGCCGAGTCCGTCACACAGAGGTGACATGTGAGCTGCTGTTTCCATTCAGAGCTACAGGAGTAACGGGCTGGGAAAAACAGGTGTCCTGCTAGACAGTGGCTGTGAGGATGTGTAGGCAGGAGCAGTGGCAGCCACCTGGGAGTCAGGAGCTTGCAGCACAATGGTGCTGGCTGTGTGCGCGCCTGGCTCTGCCACATGAGCGTGGAAGGCACCACCTGAACATGGCTTTTGAGGGGCCTAGTCATCCTAGTCATTTACTGGGGCAGCTTCCTGAGTGGAAGGAACATAAGGGCACAGGTATCATGGTAAACTTTTGAGTCTAAGGGATGATGCTTGACAGCCACACATGGTGGGTGTGGCCTGCAGCTACAAAGGGTGGGGCCAGACAGCTGGGCCTCCACTCAGCCCACCACCACCTCCAGGGCCTGGCATTTCGCCTTTGTGCTCCAGGACCTCAGGGGCGGGGATGCAGGACAGTTCTGGGGAAAATCTACTTGTAAAGGTCCTGGGGAAGGGGACAGGAGTGGCTGGAGGCTGTGCTCCGTGGGAAAGTTCTTCTCACCAGAGCACACATCAAATGCCAGTTCCAGAGAGGGACCCTCCGCCCGACTGTGCTCTCCTAGGGCAATCAGGAGGAGACTGCCCTCCAACTGGGCCCTGGCTCTCCGGGGTGTTGCTGTGAGTACAAGGCTGTCCTCAGGCAGCTGCCTCAGATTTGGGCTGGGACTGGGCCAGACGGGGTTCCCGGGGCAGGGGCAGGAAGGAGGCAAGGCTGGCAAGGGGATTGGGGGCTGCTCTCAGGAACACGGAGAGGCCGCATTAGGCAGGCAGGGAAGTGCTGGGAAGACTACGTGCTCCTCTCCCACCAGGGACCCTGGCGGCCCTCCTGCTAGTTCTCCTCCTGGTGGAGGACACTGGGGGATGCCGAACAAGAGGCTAAGCCTGCGGCCCAGGCCCTGCTGAGACCACACCATGGCTAGCAAGTAGAGGGACAGCAGCATATCCCCTCAATTCTGCCTGCACGGTAGCTGAGCCAGACGTCCCCACACCCACCCCATTATCAAGGAAGATC

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT146050
lncipedialnc-PLD6-1-1_dup1
gencodeENST00000584203.1
ensemblENST00000584203
PMID26117828PNCT_HSA047040