An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT147714.1

General info


NONCODE TRANSCRIPT IDNONHSAT147714.1
NONCODE Gene IDNONHSAG054063.2
ChromosomechrX
Start Site14244381
End Site14244928
Strand+
Exon Number1
CNCI Score-0.0237568
Length547
Assemblyhg38
Other transcript VersionsNONHSAT147714.1(old version)

Sequence


>NONHSAT147714.1
AAACCTTCTGCCACCCAGCAGAAGAAAAACACCAAACTCTCTAGCAAAACCACTGCTAAGTTATCCACTAGTGCTAAAAAAATTCAGAAGGAGCTAGCTGAAATAACCCTTGATCCTCCTCCTAATTGCAGTGCTGGGCCTAAAGGAGATAACATTTGTGAATGGAGATCAACTATACTTGGTCCACTGGGTTCTGTATATGAAGGTGGTGTGTTTTTTCTGGATATCACATTTTCATCAGATTATCCATTTAAGCCACCAAAGGTTACTTTCCGCACCAGAATCGATCACTGCAACATCAACAGTCAGGGAGTCATCTGTCTGGACATCCTTAAAGACAACTGGAGTCCCGCTTTGACTGTTTCAAAGGTTTTGCTGTCTATTTGTTCCCTTTTAATGGACTGCAACCCTGTGGATCCTCTGGTTGGAAGCATAGCCACTCAGTATTTGACCAACAGAGCAGAACACGACAGGATAGCCAGACAGAGGACCAAGAGATACGCAACGTAATTCACATAATTTGTATGCAGTGTGAAGGAGCAGAAGG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-GLRA2-2-2_dup1
NONCODEv4NONHSAT147714
ensemblENST00000411687