An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT147879.1

General info


NONCODE TRANSCRIPT IDNONHSAT147879.1
NONCODE Gene IDNONHSAG018365.3
Chromosomechr16
Start Site2839655
End Site2841328
Strand-
Exon Number4
CNCI Score-0.0876544
Length873
Assemblyhg38
Other transcript VersionsNONHSAT147879.1(old version)

Sequence


>NONHSAT147879.1
AATGCGGCCACTCCAAGGAGGCCGGGAGGATTGTGGGAGGCCAAGACACCCAGGAAGGACGCTGGCCGTGGCAGGTTGGCCTGTGGTTGACCTCAGTGGGGCATGTATGTGGGGGCTCCCTCATCCACCCACGCTGGGTGCTCACAGCCGCCCACTGCTTCCTGAGGTCTGAGGATCCCGGGCTCTACCATGTTAAAGTCGGAGGGCTGACACCCTCACTTTCAGAGCCCCACTCGGCCTTGGTGGCTGTGAGGAGGCTCCTGGTCCACTCCTCATACCATGGGACCACCACCAGCGGGGACATTGCCCTGATGGAGCTGGACTCCCCCTTGCAGGCCTCCCAGTTCAGCCCCATCTGCCTCCCAGGACCCCAGACCCCCCTCGCCATTGGGACCGTGTGCTGGGTAAACGGGCTGGGGGTCCACTCAGGAGAGGGCCCTGGCGAGTGTCCTTCAGGAGGTGGCTGTGCCCCTCCTGGACTCGAACATGTGTGAGCTGATGTACCACCTAGGAGAGCCCAGCCTGGCTGGCCAGCGCCTCATCCAGGACGACATGCTCTGTGCTGGCTCTGTCCAGGGCAAGAAAGACTCCTGCCAGGGTGACTCCGGGGGGCCGCTGGTCTGCCCCATCAATGATACGTGGATCCAGGCCGGCATTGTGAGCTGGGGATTCGGCTGTGCCCGGCCTTTCCGGCCTGGTGTCTACACCCAGGTGCTAAGCTACACAGACTGGATTCAGAGAACCCTGGCTGAATCTCACTCAGGCATGTCTGGGGCCCGCCCAGGTGCCCCAGGATCCCACTCAGGCACCTCCAGATCCCACCCAGTGCTGCTGCTTGAGCTGTTGACCGTATGCTTGCTTGGGTCCCTGTGA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT236314.1
NONHSAT147875.2
NONHSAT147876.2
NONHSAT147877.2
NONHSAT147878.2
NONHSAT147880.2

Data Sources

Source NameOld Id
ensemblENST00000480827
NONCODEv4NONHSAT147879
PMID26117828PNCT_HSA041347
lncipedialnc-PRSS22-2-6