An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT151167.1

General info


NONCODE TRANSCRIPT IDNONHSAT151167.1
NONCODE Gene IDNONHSAG000443.2
Chromosomechr1
Start Site15720311
End Site15732452
Strand-
Exon Number4
CNCI Score-0.0491520
Length684
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT151167.1
AGAAGCTGGTCTGGCAATCCTCATGGCACGTAAAGAGGCGGTCATCCGTGAGGACCAGGCAGCAGGATTTCCGGGGATCTCAGAGCCTAAGTTCTAAGATACAGAAAACCGCGTCTCTCGGTCCCAAAGCAGGCTCCTGCCAAGCCCATGTGTTCTTGCTCCGGCTCCTGTGATTCTCCTCAGCACACGCAGTTGCACCCAAGAGGAGCCCTGAGAGCAGGGCAAGGAGACACTGCCCTGGCAGCTGCAGTTGCACAATCTCCAAATTGCTGAGGGGACACCTCCATCCATGGATCCATCCTTGCCCTGGCTCTTCCGGCAAGGCCCACCCCTCCAACTCCTCTAAGGTGGCCCATGGGCCCAACCTAAGGAGACTGTGCCGCCTTCTTCAGCTTGCACGGAGATAAAGAGGGGAAAATGGCCAGTTTTATCCATGAACACCAGGGCCTAAGGTTTGAAAGAAACCAGGCTGTTCCAGTAAATCATTGGGTCAAGACAACAAAATGACCTGCAGCTTCTTCCTCGGTCCCTGATGCAAAGGGTGCGACCATCCCAAACACATCAGCGAGCGCAGAAGGAACTCAGAGAAATCGGACGGACACACAGGACACAGTGGCAAGGTTTCCCTGCGCTTCAGACCTGCCTGGTTCTCTCTTCTTCTAGGGGTTGCTTAACCTCCTTCTG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
0.0481830000000.146177
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0.45783300.1088890000.1008290
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.1490550000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
08.2648305.247286.69784
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
13.3131006.558420
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset