An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT155365.1

General info


NONCODE TRANSCRIPT IDNONHSAT155365.1
NONCODE Gene IDNONHSAG005603.3
Chromosomechr10
Start Site34815767
End Site34816387
Strand+
Exon Number2
CNCI Score-0.0081920
Length302
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT155365.1
GCGCTCCCGGGGAAAGCAGTTTGTGCTCAGTGCGGTCTGCAGCATAAGGAATCCTAACGCGAATCCGTGAACAGTCTATTCCGACGGCGCAGAGAAATCTCACGCGGGGATCCCCACGATGTGCCGGCGCTTAACGCAGACGCCCGAACCCAGGGGAAGGCTGCGACTCCGCGATGAGTGACATGCGGGCTTGAGACGTTCTAAAGGAACGTGGACCGAGTTAGGGAACGTAACTGAAGCTCATTTTGTCTTAGTTATGGACTATGAGTCCTTAATAAATGTATGTCATTATGTTTAAAGAA

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
000000.26581100
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0000.173830.375407000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00.2693150.24226400000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT228167.1
NONHSAT012704.2
NONHSAT012705.2
NONHSAT012706.2

Data Sources

Source NameOld Id
PMID24463510ENSG00000226386_dup1