An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT159247.1

General info


NONCODE TRANSCRIPT IDNONHSAT159247.1
NONCODE Gene IDNONHSAG008675.3
Chromosomechr11
Start Site65500307
End Site65501972
Strand+
Exon Number2
CNCI Score-0.0524288
Length471
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT159247.1
GTAATTACCAACTTAATGTTTTTGCATTGGACTTTGAGTTAAGATTATTTTTTAAATCCTGAGGACTAGCATTAATTGACAGCTGACCCAGATGCTATAGTACTATTGACAAACTGGGTTAGAGAAGGAGTGTACCGCTGTGCTGTTGGCACGAACACCTTCAGGGACTGGAGCTGCTTTTATCCTTGGAAGAGTATTCCCAGTTGAAGCTGAAAAGTACAGCACAGTGCAGCTTTGGTTCATATTCAGTCATCTCAGGAGAACTTCAGAAGAGCTTGAGTAGGCCAAATGTTGAAGTTAAGTTTTCCAATAATGTGACTTCTTAAAAGTTTTATTAAAGGGGAGGGGCAAATATTGGCAATTAGTTGGCAGTGGCCTGTTACGGTTGGGATTGGTGGGGTGGGTTTAGGTAATTGTTTAGTTTATGATTGCAGATAAACTCATGCCAGAGAACTTAAAGTCTTAGAATGG

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
0003.59348e-8900.101506
foreskinheartheart_RHLF_1HLF_2kidney
00.0070689000.04727680.0301472
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.02556790.02429020
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset