An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT159250.1

General info


NONCODE TRANSCRIPT IDNONHSAT159250.1
NONCODE Gene IDNONHSAG008675.3
Chromosomechr11
Start Site65503359
End Site65504488
Strand+
Exon Number3
CNCI Score-0.0860160
Length809
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT159250.1
TTCCTGTGGGCTTCAGTGATGGGATAGTACACTTCACTCAGAGGCATTTGCATCTTTAAATAATTTCTTAAAAGCCTCTAAAGTGATCAGTGCCTTGATGCCAACTAAGGAAATTTGTTTAGCATTGAATCTCTGAAGGCTCTATGAAAGGAATAGCATGATGTGCTGTTAGAATCAGATGTTACTGCTAAAATTTACATGTTGTGATGTAAATTGTGTAGAAAACCATTAAATCATTCAAAATAATAAACTATTTTTATTAGAGAATGTATACTTTTAGAAAGCTGTCTCCTTATTTAAATAAAATAGTGTTTGTCTGTAGTTCAGTGTTGGGGCAATCTTGGGGGGGATTCTTCTCTAATCTTTCAGAAACTTTGTCTGCGAACACTCTTTAATGGACCAGATCAGGATTTGAGCGGAAGAACGAATGTAACTTTAAGGCAGGAAAGACAAATTTTATTCTTCATAAAGTGATGAGCATATAATAATTCCAGGCACATGGCAATAGAGGCCCTCTAAATAAGGAATAAATAACCTCTTAGACAGGTGGGAGATTATGATCAGAGTAAAAGAGGCATTTCATCCTTCATGAAGCCATTCAGGATTTTGAATTGCATATGAGTGCTTGGCTCTTCCTTCTGTTCTAACTTCACAGAGAATGCAGTTGTCTTGACTTCAGGTCTGTCTGTTCTGTTGGCAAGTAAATGCAGTACTGTTCTGATCCCGCTGCTATTAGAATGCATTGTGAAACGACTGGAGTATGATTAAAAGTTGTGTTCCCCAATGCTTGGAGTAGTGATTGTTGAAGG

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
001.04181e-2095.68721e-2010.05972430
foreskinheartheart_RHLF_1HLF_2kidney
00000.3725270
liverliver_RlunglymphNodeovaryplacenta_R
00000.0863450
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00004.75138e-2470
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset