An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT160199.1

General info


NONCODE TRANSCRIPT IDNONHSAT160199.1
NONCODE Gene IDNONHSAG063368.1
Chromosomechr11
Start Site31786438
End Site31786971
Strand-
Exon Number1
CNCI Score-0.0004096
Length533
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT160199.1
TTTGACACCATCTTCCAGGATGGAGATTATTTGTGAAGACTTCAGTAGAATCCCAGGACTAAACGTCTAAATTTTTTCTCCAAACTTGACTGACTTGGGAAAACCAGGTGAATAGAATAAGAGCTGAATGTTTTAAGTAATAAACGTTCAAACTGCTCTAAGTAAAAAAATGCATTTTACTGCAATGAATTTCTAGAATATTTTTCCCCCAAAGCTATGCCTCCTAACCCTTAAATGGTGAACAACTGGTTTCTTGCTACAGCTCACTGCCATTTCTTCTTACTATCATCACTAGGTTTCCTAAGATTCACTCATACAGTATTATTTGAAGATTCAGCTTTGTTCTGTGAATGTCATCTTAGGATTGTGTCTATATTCTTTTGCTTATTTCTTTTTACTCTGGGCCTCTCATACTAGTAAGATTTTAAAAAGCCTTTTCTTCTCTGTATGTTTGGCTCACCAAGGCGAAATATATATTCTTCTCTTTTTCATTTCTCAAGAATAAACCTCATCTGCTTTTTTGTTTTTCTGTG

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000000
foreskinheartheart_RHLF_1HLF_2kidney
00.1263050000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.10434200
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
02.023356.08591.95874.83395
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
6.15136007.227230
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
lncipedialnc-IMMP1L-4-1