An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT162539.1

General info


NONCODE TRANSCRIPT IDNONHSAT162539.1
NONCODE Gene IDNONHSAG011876.2
Chromosomechr12
Start Site89947694
End Site89949793
Strand+
Exon Number2
CNCI Score-0.0004096
Length377
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT162539.1
AGCAACTCTTCATGTGGGCTCTTCCCTTCCCCCTTTCAAAACTTGCAATTAACCCTGGGTCCATCTTGAAAATCTTACTGTGATTCATGAATATAAATATTCAGTATCTTTCACTGTATCTATGCCCACTATTGAGCAGGTCTATATTTTCAGTCCTGTTTATATGCTATTTACAATGATCGTCAAACACACTTAAGCAATTCCTTTTTATTCCTCATGCAATGGGAAGTAAGCAAACATTCCATGAGGTTCATTTTATGAAGCAATAAAAGAAAGTTAGTCATCAAATAAAATAAAATGGTAAAATCAAGAGACTTACTTATTCAAACTGTTTACAATCTTTCAAATAAAAATAAAAATGATTTTATAGAAAACAG

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
006.98851e-05000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
00000.2355140
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.1798262.8312e-050
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT029834.2
NONHSAT029835.2

Data Sources


Source NameOld Id
PMID24463510XLOC_009827