An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT163439.1

General info


NONCODE TRANSCRIPT IDNONHSAT163439.1
NONCODE Gene IDNONHSAG010824.3
Chromosomechr12
Start Site31779062
End Site31780226
Strand-
Exon Number2
CNCI Score-0.0004096
Length241
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT163439.1
CAAGTCCAACACTATCAAATTATAAAGAAGAATTTCAGTAGCAGCTCGGATTACAACCTCACTCACTCCACTGAGCCACTCTGAGTATTGCAAAACACTTATAGGATGCAGGTATTGCTAGGTCTGTTGTCGTCTGGATGATTATAGCACAAGTGAAACAGAAGACTAAGAGATTTGAAGGCGTTAA