An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT163523.1

General info


NONCODE TRANSCRIPT IDNONHSAT163523.1
NONCODE Gene IDNONHSAG065438.1
Chromosomechr12
Start Site49595141
End Site49596254
Strand-
Exon Number2
CNCI Score-0.0614400
Length790
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT163523.1
GTTTGCTAAATGCCTTGTTTATTCTGCAAACAAGGCTTATTAAAAAAAAGAAATGTACAGACACACTTTGTAGGTTGAGAAATCTCTGTGTAGTTGTGACTTCACAACTATACTTCGGCAAAAGCAGTAATGACGGTGGCTTCTGAACACATTAATCTACCATTGTTTTGTCTAGAGCGAACACAGTGAGAATGGATTCCTAATGGCCTGTTTCTCTAAGTGATCGTCACATTTCGCTGCTCTATCTTTAAGAACTAGTGGAGCCTTCACTTGAGCTGCCATCTCCTTGCTGCTCAGGGCTTCAACAATTGTAATCACAAACTCAAAGCTGGTCCTAGGCCCTGGGCTTATAAGAATTTCAGGCCGTCCTTTTCCACACGATTCTCAGAGTAGGTGTAATGGCTTCCATTCATCATTTTGTCCTTAGCAAGCGGGAGTGTTGTAACTTTACTTCCAAAACTGATCTCATGAGCCATCAGAGCAGTAGGACCTGCACAGATAGTGGCTATAAGGCCCTTCTGGTTTTCCTGCTCCTTTAGTATCTCCTTCACAGAAGCAGACTCAGGTAAATTCTGTGCACCCAGATTACCTCCTGGTAGAACTACTATGTCATATGGTCCCTCTTTTTTTGCATCTTCAAGACTGGCATCAGGACAAATGAAAACATCAAGGCTACACTGTACTGGGTCTTTTCCAGCCAGACCTGCAATGGTGACCTTAATCCCAGCTTGCCTCATGACATCTACAGGATGACCGTCTCCATTTCCTCTGCTCCTTTAGCCAAAAACTC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
00.08790180.20192400.1051310.0419944
foreskinheartheart_RHLF_1HLF_2kidney
000000.057667
liverliver_RlunglymphNodeovaryplacenta_R
00000.4348540
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.15756400.0648367000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
09.3907403.964519.40725
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
6.01201008.930450
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
PMID24108091m130127_033614_00126_c100