An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT163727.1

General info


NONCODE TRANSCRIPT IDNONHSAT163727.1
NONCODE Gene IDNONHSAG011670.2
Chromosomechr12
Start Site71047401
End Site71118247
Strand-
Exon Number3
CNCI Score-0.0176128
Length565
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT163727.1
cttcggctcgcgcacggtgcgcgcacccactgacctgcgcccactgtctggcactccctagtgagatgaacccggtacctcagatggaaatgcagaaatcacccgtcttctgtgtcgctcacgctgggagctgtagaccggagctgttcctattcggacatcttggctcctccccaagagttctggagtctgagaagtcaaggatcggggtgctggcctattcagttcctggtaagggctgtcttcctggcttgcagttgaactacttcttgctgtgtcttcacaagcctgccctgccctccctcctgtgcctataaagactccagactcggtagagggaagagaagcagcttgactggacagaggtgacttgacttcagagggatggcaggactttggaggagagacaacttgactttggagagactgcttgacttcagggaagagctgacctgagacagctgaactttgggggaagattacctgcctgtcctgtcccctctccagctctcctctccactagagccatttccattgctaaataaaattctccacttccaccatc

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000.104509000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
000020.2221
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
11.6651006.81790
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset