An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT167109.1

General info


NONCODE TRANSCRIPT IDNONHSAT167109.1
NONCODE Gene IDNONHSAG013998.2
Chromosomechr13
Start Site95833043
End Site95867427
Strand-
Exon Number9
CNCI Score-0.0122880
Length942
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT167109.1
TTAGGCATGAAGGAACTGACTCTCAAGCAGACCTAGAAGATATCATTGTTGTATTAAACAGCTTCAAAAGCAAGATACTCAAAGTAAAAGTGAAAAAAGAAACAGACAAAATTAAGGAAGATATCCTTACCGATGAAGATGAAAAAACAAAAGGACTGTGGGATTCCATTAAAAGTTTCACAGTAAGCTTGCATAAAGAAAACAAAAAGGAAAAAGATGTCCTAAACATTTTTTCAGTTGCTTCTGGTCATTTATATGAACGTTTTTTAAGAATTATGATGCTTTCTGTTTTGCGTAACACCAAAACACCAGTGAAATTCTGGTTGCTAAAAAATTATCTCTCACCGACATTTAAAGAAGTAATTCCTCACATGGCTAAAGAGTATGGATTCCGATATGAACTAGTTCAATATAGGTGGCCCCGTTGGCTTCGTCAACAGACTGAAAGACAGAGGATTATTTGGGGTTACAAAATTCTTTTCCTTGATGTTCTTTTCCCACTAGCAGTGGACAAAATCATTTTTGTTGATGCTGACCAGATTGTGAGACATGATCTAAAAGAACTTCGAGATTTCGATCTGGATGGAGCTCCTTATGGGTATACTCCATTTTGTGATAGCCGCAGGGAAATGGATGGATATCGTTTCTGGAAAACAGGATACTGGGCATCACATCTTTTAAGACGGAAATACCATATCAGTGCTTTATATGTAGTGGATCTCAAGAAGTTCAGGAGAATTGGAGCAGGTGACAGGCTCAGGAGCCAGTATCAAGCTCTCAGTCAAGATCCAAACAGTCTTTCAAACCTAGATCAGGATCTCCCCAATAATATGATTTACCAAGTCGCCATTAAGTCTCTTCCTCAAGACTGGCTGTGGTGTGAAACCTGGTGTGATGATGAATCCAAACAAAGAGCCAAAACAATTGATCTGTGCAATAATC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
002.79748e-09000
foreskinheartheart_RHLF_1HLF_2kidney
03.02851e-0900.0786620.02500873.61636e-10
liverliver_RlunglymphNodeovaryplacenta_R
000.03674120.071830900
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.04486700000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
043.7399029.40170.60687
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
0.393304002.044659.03336
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT167108.1

Data Sources


Source NameOld Id
PMID24108091m130127_011620_00126_c100