An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT173415.1

General info


NONCODE TRANSCRIPT IDNONHSAT173415.1
NONCODE Gene IDNONHSAG020229.2
Chromosomechr16
Start Site86741151
End Site86741909
Strand+
Exon Number3
CNCI Score-0.0798720
Length252
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT173415.1
CACACAACAGAAGAAACCACGCTGGTGAGGTCAGCAGGGGACAGGGAGACCCTCCCTGCGGGAGCCGCTGCTAGAGGGAAAGGCAGCGTTGGATCGGATGCCGGCCCCAGCCTGGGAGACGTGCTTCCTCTGCAGCCTGTGATCAGGAGCGAAGTGTAGAGACCAGAATCGTTCAGAGGCAGGGCTGGTCCCTGTTGATTTATGACTCAGGTGGAAGATAGAGGAGGCTATACAGGGAGGCTCAGCTGTGCC

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
000019.2983
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
21.8319007.630920
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT173414.1
NONHSAT144235.2
NONHSAT144242.2
NONHSAT144243.2
NONHSAT144244.2
NONHSAT144245.2

Data Sources

Source NameOld Id
PMID24463510LocusForward_11146