An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT173465.1

General info


NONCODE TRANSCRIPT IDNONHSAT173465.1
NONCODE Gene IDNONHSAG020343.2
Chromosomechr16
Start Site89444081
End Site89458054
Strand+
Exon Number2
CNCI Score-0.0122880
Length534
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT173465.1
ATAAATAACAACTCACTTCGGTATTTTACAAAAAAGGTAGTTAAGTATTTTTTTTGTGTTCCTGCATAAAATACTAGTAAGACTCAAAACAGGTAGATACTGATATGCAAGTTTTAAAATCACAAGCAGAAGAAACAACACTCTGTATGCCCTTCCAGGTGGAAATGCAGTCAGCAGAAAACTGTCTCCATGAGATAAATGCTCCTGCCCAAAGCCCACTCTAGCAATGCTTCCTCCCTGAACCACAACTCTGAACAGGCTGCCACTCACTGCAACTCCTTGCACATGACAGACTTGCTGGGAAGAGCAGGGGTATAAACATCACTGAAGAAATCCAGGTACATGTGAAACACACAAGTGTGGAGCTGAATGGAGCCACGCGAACCAATACACAATCGTCAGATTCAGACCCAGACCCCAGCTGAGACGGCACCTCGCAATGACTTGCTCCCAAAGAAAGATGTTCTGGCCAGAGCCCTGGAGACCCCACACCTGGGGACTGGAGACCGCAGCCATCCACCTGCAACTCTGTTC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
0.2948060.084979900.20803700
foreskinheartheart_RHLF_1HLF_2kidney
00.16263300.26093400
liverliver_RlunglymphNodeovaryplacenta_R
0.048087300.11831100.255170
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.5566040.05000490
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
30.187610.963708.8551217.1436
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
11.6276006.00950
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT173463.1
NONHSAT173464.1
NONHSAT144526.2

Data Sources


Source NameOld Id
PMID24463510blastnPan.Locus_54930