An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT173619.1

General info


NONCODE TRANSCRIPT IDNONHSAT173619.1
NONCODE Gene IDNONHSAG018659.2
Chromosomechr16
Start Site13928903
End Site13930908
Strand-
Exon Number2
CNCI Score-0.0004096
Length247
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT173619.1
AGTATTTTAATCTCCCACCTGAATTCTGACCAAAAGCTTTTTCCGTTGCTCTCAGAGATTCCAGAAGATTAAGAAATGTGACACAATCATACTGAGAGAGATACTGCAGCAAAGTTCGTAATATCTTCAAATCCTGAACTAAGGATTTAGTCTTGGCTCCAAGCTGGTGCCACAAAGGATCCAGATAATGGCGGATTGTCTAAAACAAGAATAAAATTTGTGACATAGAGATTGACTCAGAGTTTAA

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000.827909001.01953
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0.07603830.00251748001.162444.1963400
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
2.971890.381967003.9314008.17609
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
03.5504602.375761.14113
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT140657.2
NONHSAT140658.2

Data Sources

Source NameOld Id
PMID24463510LocusReverse_10926