An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT173740.1

General info


NONCODE TRANSCRIPT IDNONHSAT173740.1
NONCODE Gene IDNONHSAG072090.1
Chromosomechr16
Start Site28884654
End Site28885845
Strand-
Exon Number2
CNCI Score-0.1060864
Length212
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT173740.1
TTGTCCTAGAATCTCATGGCTCCTCCCTGGAGGATTTTTGAGGAGGCTGAAGGAGACAGGACAGTTCTCGAGGTGTCTGTGGCCCTATGTCCATGTGGAAGGGGTGGGCTGGTGGCTATCTAGAGAGTAGGCAACAACATCCAGCCTTCTCCCACTACCCGTCCCGTTTCAGGCTTGGGACAGAATGGAAACGTCAAGCAGGCCAGCAGACC

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
02.83323.4327500000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0000001.389540
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
02.2358402.7679821.5725
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
27.54090024.20790
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510LocusReverse_10866