An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT176066.1

General info


NONCODE TRANSCRIPT IDNONHSAT176066.1
NONCODE Gene IDNONHSAG073590.1
Chromosomechr17
Start Site28490488
End Site28491908
Strand-
Exon Number5
CNCI Score-0.0602112
Length509
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT176066.1
AGCTCCCAGGGCTAAGGGCAGGGACCTGGGCTTCTCTCACCAACTTTGCCACTTACTTGAAGCCCAGGAAGAGGATCTGCAGCCACAACCAGGCCAGCAGCAGCAAGATGACCATGGTGGGGAAGGCGAAGCTGAACCAGGAGGCGAAGTTCACCACGTTCACTCACGAGTTGATCTGGCCTTGCAGCACCAGGTTGGGTGCGGTGCCAGTCAGCGTGGCGATGCCCCCGATGCTGGCGGAGTAGCCACCAAGCTTGGTCACCTCCTTCTGGGGACTTGGTTCCTGGAGCTCGAAGGTGCAGCTGGTCCAGGACGGCATGTGCGATGGGCACCATCATGGCTGAGGTGGCCGTGTTGCTGATCCACATGGACAGGAAGGCCGTGACCAGCATGAAGCCCAAACTCACGGGGCAGGCCGCACCCCAACGATGAGGAGGACACGGAGGGCGATGCGTTTATGCAGGTTCCAGTGTTCCACCGCGATGGCCACCAGCAGCCCCCCGAAGAAC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
00.062306400.1320430.03187740
foreskinheartheart_RHLF_1HLF_2kidney
00.05402910000
liverliver_RlunglymphNodeovaryplacenta_R
00.163070000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000.2422420.1115520.2276570
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
000030.9094
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
20.75810027.72130
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
PMID24463510blastnMouse.ENSMUSG000000