An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT177384.1

General info


NONCODE TRANSCRIPT IDNONHSAT177384.1
NONCODE Gene IDNONHSAG023274.2
Chromosomechr18
Start Site6256729
End Site6259258
Strand+
Exon Number3
CNCI Score-0.0532480
Length386
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT177384.1
ACGTGACCCACTAAGGATTCTGCTCCAAGGACAGTGGGTTTCCCGCTGGGCACCCACTCTTAAGTGCAGATCGGGAGACTAAGACAGGAACACCCGCCGTGGGCAGGCCAGGCTGGAAGGATAGAGGACTGTGGTCGAACCAAGGGGAGGTTCAACTGTGACTTATGCCAGTGTGGTCACGAAGGCAGATGGGTTGAACTGAAAAGGGGGCACCGGTTCCTGGCATGGAGGCACCCAAGGTCTTAGGAGGTGGATGGACTGTCACATGGGCAAAGAAATGTCCCAGGGCAGGACTGCAAAGGCCACAGAAGAATAATTTGGGAGAGAGACAACCCATGAGAAGTCACTCAGACCAGGGTCAGAAACAGAACAGGAACAACAATGGA

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
0.12545900000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
0007.89663e-2780.0789790
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
007.61691e-17200.04656930
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
0.930934004.997730
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT057106.2
NONHSAT057107.2

Data Sources


Source NameOld Id
PMID24463510LocusForward_8540