An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT178331.1

General info


NONCODE TRANSCRIPT IDNONHSAT178331.1
NONCODE Gene IDNONHSAG075084.1
Chromosomechr18
Start Site31624670
End Site31631131
Strand-
Exon Number4
CNCI Score-0.0004096
Length1493
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT178331.1
TTTAACCGTGCGATGCTTTTCAATGTGGGCTTCAAAGAGGCCATGAAAGACAGTGTCTGGGACTGTGTAATCTTCCACGATGTGGATCATCTACCTGAAAATGACCGGAACTATTACGGATGTGGAGAAATGCCACGTCATTTTGCTGCAAAGCTGGATAAATACATGTATATGTAATCTTCCATATAAAGAATTTTTTGGTGGTGTAAGTGGGCTGACAGTGGAACAATTTAGAAAGATCAATGGTTTTCCTAATGCCTTCTGGGGATGGGGAGGAGAAGATGATGACCTTTGGAACAGAGTTCACTATGCTGGATATAATGTAACCAGACCAGAGGGAGACTTAGGAAAATACAAGTCAATTCCTCATCACCATAGAGGTGAAGTCCAGTTTTTAGGACGGTATAAATTACTAAGGTATTCCAAGGAGCGTCAGTACATCGATGGACTGAACAATTTAATATATAGGCCAAAAATACTGGTTGATAGGTTGTATACAAACATATCTGTAAACCTCATGCCAGAGTTAGCTCCAATCGAAGACTATTAAAAGAAGTGGCTGTCGTGGCAAGGTAGACCACAATGCTGGATCATAAACTTGGAGCGCGCTCTTAGTGGAGGTCAGTGATTGGCTGTGTCACAGTGCCCTTTTCTCTGAGAAGAGCCAGCAGTCCACAGTGTTTACAGAGTGGGACTATATACAGTCACCCTTCTCTCACCCGTCCTCCCTGCTCTGAGACACACCCCTGTGGCGAGCACCGCAGAAACGGGAAGCCACTACTTAAGATCGGAAGTTAAGAGAGCTCCCTCCGAAGAGAAAATTTTTATACTAAAATCTATAATTTAATTCAAGAGAATGCTTTTATTTCCGTTTAAACATATTTTGTATATATGTGATATAAATTAATGTGTGCAAATTGTTTAAAAATTAGATGTGTTGCAGTTTTGCATGTAATCGGTTATACCTTTATTGGACTTTTATAGACATTTTTTATTTGCATGAAAAAAACTCACTAAATTTACATCACTAAACAAAGGTTAACCCTTGTGTGAAATGAAGGAACTGTCAATAATTGACAGCCAACTAATACAGTAAACTGTTATACTAGTTTTGAGCTTTAGACCTCAGCCTTTTGTGTGGAAGAAGTCACAGCTTTCTTAGGCTTTAAAGGAAAAGAAGGAAGGACTTAAATAGCTTTTCTTCCTACCGGGATTACCTATGTTTTTCCTTGCTTGCAATCTCATCTGATTTTGCTAGAAATCACAACCATATTGTTTATGCATATTGCATGAGTATTACCAAGAAAAATCTTAAAAGTTGTGATGTGACATGATATAAAGGATCTCTTTATGTTAAATGTCTTTCCATGTACCTCTGGTGTGTCAGGGATTTTGTGCCTCAAAAAATGTTTCCAAGGTTGTGTGTTTATACTGTGTATTTTTTTTAAATTCACGGTGAACAGCACTTTTATTATTTCCAGTTCAGAAGAGCC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
0000.062443200
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.029073800
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
05.199084.9455399.78343.82368
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
7.08440010.316422.9318
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
PMID24108091m121218_085412_00126_c100