An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT179697.1

General info


NONCODE TRANSCRIPT IDNONHSAT179697.1
NONCODE Gene IDNONHSAG076107.1
Chromosomechr19
Start Site35848731
End Site35849600
Strand+
Exon Number2
CNCI Score-0.0794624
Length689
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT179697.1
GTGTCACGTTCTTGTTCTCAGTCTGGGATGCAGATCCCAAGATAATAATGGCACTAGGGGGAACTGCTGACCTGCAGTGTGATGCCGTGCTCCTGGGTCCCTGCAGACACGCTGTTGTGGGCCTCGCAGCTGAGCTGCGCTCCATGGTCTTCTGGCCTCACGGTCATCACCAGCACACTGCGGGCCACCGCCTGGGTGTGCTCTGTGCCCCACGCTGTGGACACCGGCTGGCCATTCTGGAGACAGGGACAGGCCTGGGCCAGCTCAGGACTGGCTCCCAGACCCCACTGTCCCCCCATTCCCCATGCCCGCGTTTGCCCTCACCTTCAGCCACTGCAGTGTGGCTAAGGGATTACCCCCTCGGGCCACGCACGGCAGCTCCAAGCTCTGTCCTGCCCGCACGTGCCCCTCATCCAGGCCTGGCCACTCGATGACAGGGGGTCCTGGAGGGACTGGGGGATATCAGTCACTCAGTGGGCCTGGAGTAGCCCATCCACTCTTTCCAGGCCCCACAACCTGCCTTTGAACCCCCATGTTTCTCTGAGTGCCTGAATTTCCATAATCCCTGTGATCCCCCCACACCCCCCAGTGCCTGCTCCCCATCCTCAGCGCCCTAGTTGGCCCAGTTCTCCACTTACACAGAACATTCACGGTGAATGAGGCCTTGATGGGGGCCTCCAGTGCTGGGC

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
000.07351100000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0003.48160000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000.03350430.077237600
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
009.415920.42584424.0501
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
29.08930015.80820
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510blastnMacaque.Locus_11592