An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT180444.1

General info


NONCODE TRANSCRIPT IDNONHSAT180444.1
NONCODE Gene IDNONHSAG025929.2
Chromosomechr19
Start Site43203101
End Site43205621
Strand-
Exon Number2
CNCI Score-0.0184320
Length1299
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT180444.1
GACAGCACAGCTGACAGCCGTACTCAGGAAGCTTCTGGATCCTAGGCTTATCTCCACAGAGGAGAACACACAAGCAGCAGAGACCATGGGGCCCCTCTCAGCCCCTCCCTGCACACAGCGCATCACCTGGAAGGGGGTCCTGCTCACAGCATCACTTTTAAACTTCTGGAATCCGCCCACAACTGCCCAAGTCACGATTGAAGCCCAGCCACCCAAAGTTTCTGAGGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCCCAGAATCTTGCTGGCTACATTTGGTACAAAGGGCAAATGACATACCTCTACCATTACATTACATCATATGTAGTAGACGGTCAAAGAATTATATATGGGCCTGCATACAGTGGAAGAGAAAGAGTATATTCCAATGCATCCCTGCTGATCCAGAATGTCACGCAGGAGGATGCAGGATCCTACACCTTACACATCATAAAGCGACGCGATGGGACTGGAGGAGTAACTGGACATTTCACCTTCACCTTACACCGTGAGTGATTCCACATGATCCCTGGGTGTTGGGGGACAGGGGTCACTTCTACTTCACACACACAGGATTCTCAGGCCTGGACTCTGCCTGTGTCCCTCTCTGCATTAAGTCCCATGCTGGGGTTTGGGCATTTAGTGCAGGACACACAGAGGAGACAAATTTCAACAGATCAGAATTCCTTTCCCGCATTCAGACCCTGCAGACACTCGCTGCAGAGGAAGGACAGTCTGATGGGGGGACTCAGCAGGAGGAGATCAGTCTCAGACAAGCACCTCATGCCCTCTTCATAAATTTGACGCTGACAAAGACCCTGGAGAACTGAGTAGGGCTGGCCTGAGGGGCCCCCTGAGATACTCTCAGAGCAGCTCAGCCCTAGAAGCCTCAACCCCAGACCTCTGTCCCTAAATCCTTGCTCCAGATAAAGCTGAGGAGCCTGTGCCAGTGCTGGGTTGTTCCTTCTTGGGCAGGCCTTACTGGGACCAAGAATTTACCAGCTGTCAGAGGACTGTGTCTCCTGGAGCTGTTCACCAGCCAGGGCTCAGCCCTCAGAGCCTCATCTGGGCAAGGACAGAGCTTTCTTCACCTGACACTCAGAGTGGAGAGGATAGAAAGACAAGCTTTGTAGGACATCGGCTTAGGAGAGTCCATAGAAAGTCTAATGTCCCCAGAAGCAGAAACAGAAGGAGAAGATGTACCTGGTAGCAGATTGTCCACAGGGATCTGATGTAAAGGTGTTTTCTCATGGAAGCAAATTAATAATAAATGCTGTTTGTGTGAAACCTCC

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000.32894406.609790
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00.001519420.001512970.0009354830000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
057.997300000.0006798740
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000.223104
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
0000.4926680
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT180445.1

Data Sources

Source NameOld Id
PMID24108091m130127_055628_00126_c100