An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT185675.1

General info


NONCODE TRANSCRIPT IDNONHSAT185675.1
NONCODE Gene IDNONHSAG079162.1
Chromosomechr2
Start Site151485340
End Site151491718
Strand-
Exon Number4
CNCI Score-0.0307200
Length885
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT185675.1
ACAACATCCAGTCCCGAAGCTTACACATGATTAATGGTTCCAAGCTCAGCGCCGGAGCCGGGAGCAGTCACGATCTGCCAGTGCACTAAGCATCAGTGGGGGTGAGGAGAAGTCTGAGCATTCAGAAGCACCAGACCACCACCTTTCGACTTACAGCGACGGGGGTGTCTTTGCAGTCTCAACAGCTTACAAACATGCAAAAACCACAGAGCTCCCACAACAACGATCATCTTCAGTTGCTACCCAACAGACAACGGTATCTTCCATCCCATCTCATCCATCTACTGCTGGAAAAATCTTCCGTGCCATGTATGACTATATGGCTGCTGATGCAGATGAGGTGTCCTTCAAGGATGGAGATGCCATCATAAATGTTCAAGCAATTGATGAAGGCTGGATGTATGGCACTGTGCAGAGGACTGGCAGGACCGGAATGCTCCCAGCCAACTACGTTGAAGCTATTTAGGCATTTCAAAGCATCACACTTGTCTGCAGGACTTACAGATCCTGCAGTCAATGTTTCGGTTTAGACTCTCCACTGTTACCTAAGTTCTCAAGCTGCCTATGGTTTTTCTGTGTCAATGTGATTTATGGTAGTACCATCCTTTCTCCTTTGGGTTTTAAAATAAGTTGCAGAACAGACACTTTAAAAGCTTCTGCAATATTATTTCTGTGCCTAGAGTCTTTCTCCATTATAAACATGTTTTAACATTATTTCTTTTCTAAAACAGGGATTTTGAATATGCCAAACACATTAAAGGAAAAATAGCAGAGATGTTCACCTTTTCCTTGCTGATTGCTAATGCTTATTATTTCTAATTCAGTTCTGAAGTTATAAACTTATAATCAATACAAACCAGCAACTAATAAAACCTCTAATTCTGC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000000
foreskinheartheart_RHLF_1HLF_2kidney
0000.078244100
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000.5181951.8737800
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
017.287914.661217.54829.68036
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
4.110750012.33140
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
PMID24108091m130127_125837_00126_c100