An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT209239.1

General info


NONCODE TRANSCRIPT IDNONHSAT209239.1
NONCODE Gene IDNONHSAG094236.1
Chromosomechr6
Start Site56650632
End Site56650950
Strand-
Exon Number1
CNCI Score-0.0004096
Length318
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT209239.1
AGGTGGGGAAGGCATTGGTGCAAATGTGAGTATTGATTTTTCCACACCGGAAGCTGTTGATTCAGTAATGACCAATTGACTGCATTTATTGATAATGATTTTTGCAGTTTTTGAATGTTGAATATATTTTAAAGAATTTGAGTTAATATGCTGTTTGATGAATTGATATTCTATGTATTTCATGACATTATTCTACCATTAAATTTAAAGTATAACTCATTAAAACTTTTGTGTCATAAATAAAAGAGGCTATTTATAGTTACCGATCATCTTATAAATAAAAGGTTTAACTTTCTGAAATTTAGAGTTTTCCATTTT

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
0000.3495470000.349687
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0.5602420000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000.25563100
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
0121.59220.4012103.8321.79771
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
6.8501500016.0555
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-COL21A1-7-1