An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT209977.1

General info


NONCODE TRANSCRIPT IDNONHSAT209977.1
NONCODE Gene IDNONHSAG045343.2
Chromosomechr6
Start Site163165413
End Site163191808
Strand-
Exon Number3
CNCI Score-0.0172032
Length1131
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT209977.1
AAAGGTGGCTGGAAATGGAAGATGAGAGGATCCTGGACAACCTGGGGGCAGAGGGACGTCATGGCTCTGAGTGGGAGTGGAGAAGATGGCATTTTGGTGGATGGGTGGAGGAAGAGCATAGGCACAGATGGCCACGTGGAGTGTGGTCCACAGATAAGTCACCTGGTGGAGTGCAGCCACAGTGCCTGAGTCAGGAGGTCTCAGCTCTTGTTTCAGGAACACAGTCATCCCTCAGAAATGGATTGGGTGACAAGTGGTCTGCATGCTGCACACGGGCACTGGGGCAAATGGAACAAACAAAACAGTCAAAGAGGAGAGCAGGGAGAGAAGACAGATTCAGTGTTGCCCTCGGCAGATGCAGAGGAAACGAGCACAAAACCCTTTCACATGTGCCGGGCGCAAGCGACGCTGCCCAGAAACCCCGCGCCAAGCCCTGCAGCCGAGGAATTGGAGCTTCTGTGTTACTCCAAACAATGCATCTGTCTTTCATTACACTCGGATTTAGATGAAATCGGGGCGCTTGTGGGCAAACCAGTGAAGATTTCAAATAAGAGAAATTGTATTATATTAGAATCATAACGTTTTAAAAATAATTCTGTATTGAAGGAAGTTTTTAAAGAATGGCTAATGGTGCCTTAGATGCAATGAAGCCCTTTCATTCGTTCTCTCCCCCTGTCGCCCCATTCTCATCTTCACTGTCCTAAATGAGGCCTCCCTGGTCCCCTCGCCTGGGCCGTCACAGAGGCCTCTGAGTGATGTTTCTCCTCCCAGCTTTCCCCTTTCTGCCAGGCTCCCTCCCTCCAGTTAGCTTCCCGAAGCCTGGACAGGGTGAACCGACTTGAAGGCTTGAATTTGAGCCCCCTCCTTGCTCACCCCACGCTGGGCCAGCGCCTCTCCCCTGGGTTACCCTAGTGCGCTGTGCTTACCCGGATCTCAACACTTATCACAAGGATGGAGGTTTGTGGCCATTTCCCCTTTTTCCCCCTGAGACAGGGGTCTCCACAGGGGTGGGGCTTTGACCCCTTTATGGGTGTATTCTTGGTACTGGTTCCTCCAGGCAACCAATAAATATCCACTGGCTGATGGGATGAGTGATGTCACTCCCCATCCGCGGTTCCTCACTGAGATTTG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00.01938710.07496330.3506550000.0935437
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0000000.04480750
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000.08413030.16324500
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
005.7361305.31081
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
6.125410011.89370
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset