An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT213105.1

General info


NONCODE TRANSCRIPT IDNONHSAT213105.1
NONCODE Gene IDNONHSAG046817.2
Chromosomechr7
Start Site3140193
End Site3158342
Strand-
Exon Number2
CNCI Score-0.0086016
Length308
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT213105.1
GCCTTGGGAAGAAGACTCCCAGCCTGAGGGTCTTGTTGAGAGTTTTAATGTCCCCTTTAGGGACATCTTTGCTTTTCTTTCTTTCAGAAGAGGAATCAATTCTGGACCAGAGGATGTCTCCCTGCCTTTGCCCTGCCTGCCTCCCCCCACATCCTTCTCTGGCAAGGGGAATGAGGCTGAGAATGACCTCCATCCGCAGGACGAGATTCTCTAGGAAACAAGAAATCAAATCTCCGGGGACTATCCAGGTGGGAAATGGAAATAAATGATAAACATACGAATACATCGATTCTGTTTCCTATTGGTTG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
0.0001312980000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.293810000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00003.71215
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
5.942070010.4390
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset