An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT216148.1

General info


NONCODE TRANSCRIPT IDNONHSAT216148.1
NONCODE Gene IDNONHSAG050900.3
Chromosomechr8
Start Site100722932
End Site100732081
Strand+
Exon Number3
CNCI Score-0.0409600
Length434
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT216148.1
GGGTTCCTCGTCCTCTTCTTTTCCAGCCCGACCCTCCTCCGTGTCTTCACTGGACGTTGTCGTTGGTCAAAGTGGCTTTAATTTGGGATAGCTGTGTTGGGGGTCTTTGGTCACTTCTTACCTTAAGGTGCTAGGCTGGAATCATTGATTTGTGCTGCTTCTGCCAGACATTTCTTGGCGATAGAAACCAGGAGTGGAGAAAAGTGAATGTTTTTCCTGAAAGCTGAGCAAGAAAATATTTTTATGCTGAATGGTGGTCTCTCAAGAGAAAAATGGAGAAGCTGAAAGCCATTCCCATCTAAGAACTCAGAGGTGTCAGTTGTTTGCCTGCCGACGCTCTCATGTGAACTAAGAGAATGGAACCGGACATTCGTGAAGTGCTCAGTAAGCAAACAAAACGAAGACTTCTTGTGAGGGACAAAATCATTGGTTTG

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
00.1331940000
foreskinheartheart_RHLF_1HLF_2kidney
03.30076e-110000
liverliver_RlunglymphNodeovaryplacenta_R
0000.18767200
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.14225400
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
007.4741502.63443
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
1.68164002.956260
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT255283.1
NONHSAT255284.1
NONHSAT128017.2

Data Sources


Source NameOld Id
PMID24463510LocusForward_88070