An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT228167.1

General info


NONCODE TRANSCRIPT IDNONHSAT228167.1
NONCODE Gene IDNONHSAG005603.3
Chromosomechr10
Start Site34815754
End Site34816614
Strand+
Exon Number2
CNCI Score-0.0270336
Length767
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT228167.1
GTTTTGGGTGCAGGCGCTCCCGGGGAAAGCAGTTTGTGCTCAGTGCGGTGAGTCCCCTCCTCACCGCCCCGGAGGCTCCAGCCCGAGCCTCTCCGCCCGCGGGGACTCGAGCCTGCAGCTTGCTCGGCTGGGTTTCTGCCCTGCCCGCTCCCTAGCTCTGCTGCAGGGCCGGCAGCGGCAGTTCTGCCTGAAACGCAAGAATTAATAGTCTGCTCTGGGGAGACAGTGGGGAAGCCGTGAGCGACCGGGCCTTTTCCAGAGGCCACTATTTACCTTGAAGTTTCCTGTTGACCCTCTGCTGACCCACCCGCTTAAATAGATTAGAACTTAAACATCGCAATTCTGATACATTTATTTCTTTGAAGTTCTGCAGCATAAGGAATCCTAACGCGAATCCGTGAACAGTCTATTCCGACGGCGCAGAGAAATCTCACGCGGGGATCCCCACGATGTGCCGGCGCTTAACGCAGACGCCCGAACCCAGGGGAAGGCTGCGACTCCGCGATGAGTGACATGCGGGCTTGAGACGTTCTAAAGGAACGTGGACCGAGTTAGGGAACGTAACTGAAGCTCATTTTGTCTTAGTTATGGACTATGAGTCCTTAATAAATGTGTTTCCAAGACACGTGAAAGCAATCAAGCTCCCCTGGGTTGGCGCAGAACTTGAGCACTTAAGAGCTGGAAGAGCTGGCGATCGACCATCCATCCCACTCCACCTCCAATCTTAAAACAAGGAAACAAGACACGAGGTTCGTCCGCTTGCCACA

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000.207135
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.1209369.01064e-080
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00002.97097
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
1.91762003.341550
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT155365.1
NONHSAT012704.2
NONHSAT012705.2
NONHSAT012706.2

Data Sources


Source NameOld Id
PMID27557446HE-BI-PARD3