An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT237077.1

General info


NONCODE TRANSCRIPT IDNONHSAT237077.1
NONCODE Gene IDNONHSAG021170.3
Chromosomechr17
Start Site20726671
End Site20736899
Strand+
Exon Number5
CNCI Score-0.0245760
Length327
Assemblyhg38
Other transcript VersionsNone

Sequence


>NONHSAT237077.1
GTTCAAGCTCATCCATTCTTTAGACACATTAACTGGGAAGAACTTCTGGCTCGAAAGGTGGAGCCCCCATTTAAACCTCTGTTGCAATCTGAAGAGGATGTAAGTCAGTTTGATTCCAAGTTTACACGTCAGACACCTGTCGACAGCCCAGATGACTCAACTCTCAGTGAAAGTGCCCATCAGGTCTTTCTGGGTTTTACTTATGTGGCTCCATCTGTACTTGAAGTGTGAAAGAAAAGTTTTCCTTTGAACCAAAAATCCGATCACCTCGAAGATTTATTGGCAGCCCACGAACACCTGTCAGCTCTTCCTTGTCTTAAAGCCCAA

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
00.08054373.54426e-143000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT174991.1
NONHSAT237076.1
NONHSAT146829.2

Data Sources


Source NameOld Id
lncipedialnc-CDRT15L2-8:2