An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT007396.1

General info


NONCODE TRANSCRIPT IDNONMMUT007396.1
NONCODE Gene IDNONMMUG004702.2
Chromosomechr10
Start Site112270742
End Site112272338
Strand-
Exon Number2
CNCI Score-0.0618496
Length783
Assemblymm10
Other transcript VersionsNONMMUT007396.1(old version)

Sequence


>NONMMUT007396.1
GCGGCCTGACTTGCCATCGGGTCCTCCCAGCCCCGCAGCATCCTCAATGCCCAATCTCTTGGCCGCTAGGTCCTCATCATCACCAGGGTCGCCCCCGATGAGGTCGGGTGTCTCAAAGATGTCCAGGGCCTCCTCCGCGTCCCGGTGCTGCCTGTAGGTCATCCAGCAGCAGGGCTCCACGTCGGTCTCATCGATGCCCCAGAAAGCCAGCTCTTCCTCGAAGAGCGGCCCGCACACGTCGGCGGGGCAGTGCAGCTTGCCCGTGCGGTAGTAATTGAGCACATAGGCGAATACTCCTGGGTGGCGATCGAAGAAGAATTCGCGGCCTCCCCCAGGGTGGTCGCTGCCGCCGTTGCCGCCGTTGCCACCGTGCGAACTGCAGTTGCCTGCGCCGCCCTCGAAGCAGCCGCTGGGGACAGGGGACAAGGGAGGCGGTCGTGGCGGCGGAGACAGCGGAGGGGGCAGCGGTTGCAGCTTGTCCCCGGCCGCAGTCAGGCAGTCGCCCTGAGGTTCAGAGGAGGCAAGAAGGGCCAGGCAGAAGACTGAACCCAGAAGTCAGAACAACAATAACAACAACAAACGTCCTCGCTACCGCCTTTCACCAAGGAGACCTCTGACTAATTTCCTCATCCAATTTCCTTTTCACATTACTGTTGCCGTTTGTTGCTAAATGTTATTATTACTTGGGAAAGGAAACGGCTAACTAGGATCCATCTTTGAGGACAAAAGTGAGCAGTCTCTGCCACCCCTCCCCCTTCCCAAGAAAAACAAACATCTTGGGGT

Expression Profile(Data Source:ERP000591)


NA

Isoforms


Transcript ID
NONMMUT007395.2
NONMMUT082701.1

Data Sources


Source NameOld Id
NONCODEv4NONMMUT007396
PMID26117828TCONS_00001373
PMID26117828PNCT_MMU003721