An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT008765.1

General info


NONCODE TRANSCRIPT IDNONMMUT008765.1
NONCODE Gene IDNONMMUG005426.2
Chromosomechr11
Start Site20290062
End Site20290383
Strand-
Exon Number1
CNCI Score-0.1167360
Length321
Assemblymm10
Other transcript VersionsNONMMUT008765.1(old version)

Sequence


>NONMMUT008765.1
ATGCTGCCCAAGTTCAACACCGAGATCAAAGTCGTGTACCTAAGGTACACCAGAGGTGAGGTTGGCGCCACATCCACCTTGGCCCCTAAGATCGGTCCTCTGGGTCTGTCTCCAAAAAAAGTTGGTGATGACATTGCCAATGCTACTGGTGACTGGAAAGGTCTCAAGGTTACAGTGAAACTGACCATCCAGAACAGACAGGCCCAGATCGAGGTGGTGCCCTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAAGAGCCACCAAGAGACAGGAAGAAGCAGAAGAACATTAAACACAGTGGGAACATTACATTTGATGAG

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONMMUT008765
ensemblENSMUST00000121298