An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT011284.1

General info


NONCODE TRANSCRIPT IDNONMMUT011284.1
NONCODE Gene IDNONMMUG007120.2
Chromosomechr11
Start Site86506607
End Site86507031
Strand+
Exon Number1
CNCI Score-0.0491520
Length424
Assemblymm10
Other transcript VersionsNONMMUT011284.1(old version)

Sequence


>NONMMUT011284.1
AAACATTCTCACTGTAATTTCTAAAACAGAATGTTAAGATTATGAAAATCAATTTGTAGATACCAGTAAGTTATCAAAGAAATGGCTTAAAAGCAAAGTCATTCAAGCTTCCCACATAAACTTCTCACTGCATCAACCTGAGGTTTCCTACAGCTGCATGGAGACCTAAGTTCTTTCACTTACCAGAAAGACCTGGTTGGCACTTTCACTGAGAGTGGAGTCATCAGGGCTGTCAACAGGTGTCTGACGTGTAAACTTTGAATCAAACTGACTCACATCCTCTTCAGATTGCTTCATAAGAACAATGGTTAGAAAATGGTGAACAGTCTATATTATTCCTATCAATCAAAGGTGCCACAAGCCCTATATTCTTTGCACAGGGTTTAACTGTAATAAAACATGAGAATAATTTTAGCAGCCACAG

Expression Profile(Data Source:ERP000591)


NA

Data Sources


Source NameOld Id
noncodeV3n283509
NONCODEv4NONMMUT011284