An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT011703.1

General info


NONCODE TRANSCRIPT IDNONMMUT011703.1
NONCODE Gene IDNONMMUG007410.2
Chromosomechr11
Start Site96291023
End Site96306910
Strand-
Exon Number3
CNCI Score-0.0167936
Length596
Assemblymm10
Other transcript VersionsNONMMUT011703.1(old version)

Sequence


>NONMMUT011703.1
ATGTCATAGCGACTTTTGGGGTAGTTTGCTTTCGGCAAAGGGGGACAAAGTCATGGGGTGAGAGGGAAGGAGGACCCAAAACAGCCTCCAAGACCCTCACCATCTCTTCACCGGCTCCCCCTCCCCCCCCACAGGTCCTGTAAGAAGTTGGGCCCAGCTGGAAGGGATTGACCGACGCCTCTTCGCCCTAGGCTGGCCTCTGCGGAGATTCCAGGCCCCACAGAGACCAGGACTTCCCTCAGCGCCACCGCCCCTCGTGCCAATGCAGCCGGGAAATCGCCATTACCCACACTGGGCAAGAGAAACCGCACGGGGGCAATCGGAGAGGCCAGGAAAAGGGAGAGATGGAGGGAGAAGGTTCCAGGTTGGCCGTACTCAGGAGCAGGCCGAACGGCCCAGAGGAAGCCCTGGCGTCCGGTGCTGCCAGGCTCACTGCGGACGCACCCCAGCCCGGTAAACTCACTGTCGCTCGCCGGGACTGGTTTCCCTTCAATTTAAAAATTTCATGTGGATCGCCCATGCCAATTTAGAATGAAATAGATTTAAATACATAAAGTAAAAATAAATTGAAATAAAAGCAAGGCATCTGATGAAAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT085710.1

Data Sources

Source NameOld Id
PMID235831TCONS_00004462
refseqNR_131758
NAMEHoxb5os
PMID26117828TCONS_00001822
gencodeENSMUST00000150698.1
PMID26117828PNCT_MMU071635
NONCODEv4NONMMUT011703
ensemblENSMUST00000150698
NONCODEv3n417408