An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT017189.1

General info


NONCODE TRANSCRIPT IDNONMMUT017189.1
NONCODE Gene IDNONMMUG010800.2
Chromosomechr13
Start Site43035655
End Site43037528
Strand-
Exon Number2
CNCI Score-0.0368640
Length377
Assemblymm10
Other transcript VersionsNONMMUT017189.1(old version)

Sequence


>NONMMUT017189.1
TTATCGTAGATCTCCTTCAAGACCCCTCTCTTGATCAGCTCCTCTCTGCTCTGCCTCATCGAAATCTTCCTTTCCAGAGCTGCAAGCAAGAGCCAGAGAGAGAGGCAAATGAGAACGATAACCATCATCTTTCTCCTCACTCCCAAAGGACCCACATGGTAACAGATACTGCGATCTACTAAAAGAGCCCATGAGTTATGTTTTGCTAATGATGCGCTATGTGGAGAGGTGGTCCAGAGACGTTCCCTGGCCTCTTCGGCCTAACGCTGAGCTGCTCAGAGACTCACAGCACAAGTGTAAGAGGAGAGATCCCAATGTTTCTGTTTTCTCCCCAGGACATCACACTGTTGTGAGGATAATGCTATGCTATATGGAAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT017186.2

Data Sources

Source NameOld Id
PMID26117828TCONS_00003373
PMID26117828PNCT_MMU009011
NONCODEv4NONMMUT017189