An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT021103.1

General info


NONCODE TRANSCRIPT IDNONMMUT021103.1
NONCODE Gene IDNONMMUG013100.2
Chromosomechr14
Start Site60141062
End Site60141410
Strand+
Exon Number1
CNCI Score-0.0004096
Length348
Assemblymm10
Other transcript VersionsNONMMUT021103.1(old version)

Sequence


>NONMMUT021103.1
GTATGTCCGCTATCCAGAACCTCCACTCTTTCGATCCCTTTGCTGATGTAAGTAAGTAAGGGTGATGGCCTGCTTCCTGCTGGCACTGAGGATTATATCCATATAAGAATTCAACAGAGAAACGGCAGGAAGACCCTGACAACTGTCCAAGGGATCGCTGATGATCGCGATAAAAAGAAACTAGTGAAGGCGTTTAAAAAGAAATTTGCGGGCAATGGTACTGTAATTGAGTATCCAGAATATGGAGAAGTAATTCAGCTACAGGATGACCAGCACAAGAACATATGCCAGGTCCTGATAGAGATTGGGCTGGCTAAGGACGATCAGCTGAAGGTTCATGGGGTTTAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENSMUST00000100019
NONCODEv4NONMMUT021103