An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT021266.1

General info


NONCODE TRANSCRIPT IDNONMMUT021266.1
NONCODE Gene IDNONMMUG013195.2
Chromosomechr14
Start Site64096412
End Site64104242
Strand-
Exon Number3
CNCI Score-0.0163840
Length435
Assemblymm10
Other transcript VersionsNONMMUT021266.1(old version)

Sequence


>NONMMUT021266.1
GCCTCCTGAGACCTCCAGGAGATGGAGGATAGGAAGGGTGTAATGACCTGGGTGACAGTGGAATCCCAACAGACTGGTTTGTAGATGCCCCAGGACACAATGGCTAGAGGCACAGCCTTGATGAATAAGGAAGGAAGCTGAGTCTTGGAAATGTCCATCAGAATGACTGCCTCATGAAAGGTTAAACAGTTCACTATGGACGTGAGATTCGTCATAAGGAGAATGAGTAACATGGCCACCCGCTGGAAGCTGAGTTTTGGAATTCATCAAAAGTCTTCCATAAGTGACCAGCCCGGTGCTCTGCAGGAAAGGAGCCAAGCCACCAATACTCAACGCTCCAGGGAAGCCACCGGGTTGGATATCTCAACAAATGGTGGACTATATGTGAGGCAAACAGATGAACAAGCCAAATGATTTTATGGAATCCATAAAAAT

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT094486.1
NONMMUT021267.2
NONMMUT021268.2

Data Sources

Source NameOld Id
NONCODEv4NONMMUT021266
PMID26117828TCONS_00003998
PMID26117828PNCT_MMU011221