An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT021267.1

General info


NONCODE TRANSCRIPT IDNONMMUT021267.1
NONCODE Gene IDNONMMUG013195.2
Chromosomechr14
Start Site64099256
End Site64104242
Strand-
Exon Number3
CNCI Score-0.0491520
Length870
Assemblymm10
Other transcript VersionsNONMMUT021267.1(old version)

Sequence


>NONMMUT021267.1
GCCTCCTGAGACCTCCAGGAGATGGAGGATAGGAAGGGTGTAATGACCTGGGTGACAGTGGAATCCCAACAGACTGGTTTGTAGATGCCCCAGGACACAATGGCTAGAGGCACAGCCTTGATGAATAAGGAAGGAAGCTGAGTCTTGGAAATGTCCATCAGAATGACTGCCTCATGAAAGGTTAAACAGTTCACTATGGACGTGAGATTCGTCATAAGGAGAATGAGTAACATGGCCACCCGCTGGAAGCTGAGTTTTGGAATTCATCAACTCTGCCCTGATTCTTTCTTGCATGAGACCAGTTGGATCACTGCGTGCAGTGCTTCAGAAGTTCAATTCCAGATCTGGAGACTGTGGGATCGGGGTGCAAGGCTGGAGAGGGCCCTGACCTTGTATTTCCAGGAGAGCCTGCCTGATAACTGTCCATCTTCCCGGAGATGAAAGTGCTGGGACAGCTGAGAAAGGTGGACCTAGACTGAGGGTTCAGTAACCCTTCTCTTGGGCCTCTCACAACTATTTGAATCCCTGAGGTGGAATTAGGAAGGTTGACAGCTATGAGGGCAGGGCCGAGCTCAGTTAGGGAGGAGCTGGAATTTCAACACTGAAAACTTGGATGAAGACATTTTGATGTTGGCATGAACATCATGGACATTGTAGCAACTAAACAGACTAGCCAAAGCAATCAGCCATGAGGGTAGAGAGACTCTCTCCTTCCTAGACCCAGGGAAAGCCACAGGGGTGAAGAAGGGGCCATCAGTGGGAACTGGGCCAGTGACAGCACTGTGACCTAAACAGGAAGGGGAGAGGAAATAAATACCCCACTGGCCCTCTCACTTCCTGCTCTGGTGCTTTGGTTACTGCTTTCTGGAG

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT094486.1
NONMMUT021266.2
NONMMUT021268.2

Data Sources

Source NameOld Id
PMID26117828PNCT_MMU011222
NONCODEv4NONMMUT021267
PMID26117828TCONS_00003999