An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT021268.1

General info


NONCODE TRANSCRIPT IDNONMMUT021268.1
NONCODE Gene IDNONMMUG013195.2
Chromosomechr14
Start Site64099294
End Site64104235
Strand-
Exon Number4
CNCI Score-0.0491520
Length865
Assemblymm10
Other transcript VersionsNONMMUT021268.1(old version)

Sequence


>NONMMUT021268.1
GAGACCTCCAGGAGATGGAGGATAGGAAGGGTGTAATGACCTGGGTGACAGTGGAATCCCAACAGACTGGTTTGTAGATGCCCCAGGACACAATGGCTAGAGGCACAGCCTTGATGAATAAGGAAGGAAGCTGAGCCCTATTGAGCCCACCTGGGAGGATGCAACCAGAGGAACATCTTGGAAATGTCCATCAGAATGACTGCCTCATGAAAGGTTAAACAGTTCACTATGGACGTGAGATTCGTCATAAGGAGAATGAGTAACATGGCCACCCGCTGGAAGCTGAGTTTTGGAATTCATCAACTCTGCCCTGATTCTTTCTTGCATGAGACCAGTTGGATCACTGCGTGCAGTGCTTCAGAAGTTCAATTCCAGATCTGGAGACTGTGGGATCGGGGTGCAAGGCTGGAGAGGGCCCTGACCTTGTATTTCCAGGAGAGCCTGCCTGATAACTGTCCATCTTCCCGGAGATGAAAGTGCTGGGACAGCTGAGAAAGGTGGACCTAGACTGAGGGTTCAGTAACCCTTCTCTTGGGCCTCTCACAACTATTTGAATCCCTGAGGTGGAATTAGGAAGGTTGACAGCTATGAGGGCAGGGCCGAGCTCAGTTAGGGAGGAGCTGGAATTTCAACACTGAAAACTTGGATGAAGACATTTTGATGTTGGCATGAACATCATGGACATTGTAGCAACTAAACAGACTAGCCAAAGCAATCAGCCATGAGGGTAGAGAGACTCTCTCCTTCCTAGACCCAGGGAAAGCCACAGGGGTGAAGAAGGGGCCATCAGTGGGAACTGGGCCAGTGACAGCACTGTGACCTAAACAGGAAGGGGAGAGGAAATAAATACCCCACTGGCCCTCTC

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT094486.1
NONMMUT021266.2
NONMMUT021267.2

Data Sources

Source NameOld Id
NONCODEv3n292634
refseqNR_046192
NAME4930471C04Rik
NONCODEv4NONMMUT021268
gencodeENSMUST00000166038.1
ensemblENSMUST00000166038
PMID26117828PNCT_MMU101776
PMID235831TCONS_00009691
PMID26117828TCONS_00003643