An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT026571.1

General info


NONCODE TRANSCRIPT IDNONMMUT026571.1
NONCODE Gene IDNONMMUG016457.2
Chromosomechr16
Start Site38569322
End Site38573300
Strand-
Exon Number2
CNCI Score-0.0409600
Length549
Assemblymm10
Other transcript VersionsNONMMUT026571.1(old version)

Sequence


>NONMMUT026571.1
GCTCCAAGGCACCTGAAGACTTACCAGTGAAGTACAAGAAGCAGGATGATTGTACGGATACCACCACACCGTCTTATAGATGTTGATATACTGAATGAACAGAACAATCAGCAGGTAGATGAAGAAAAGAAATTCAAAGAACAGGCTCCCATCTACTGGCTCGGTCTTAGCACCATCTTCCTTGAGACTCCTGCACCATGAGAGCGATGTGGTGGAAGAAGAGAATGTGCAGGCTGAGGTGCAAGAGAAGAAAGATGAGGCAGAGGTCCAGGTAAACCAGCCTGTGCACCCTCGAAGCCTGCAGAAGTTAGGGATGCTCAAGGCCGGGACACCAGAACAAGCTGTCGGACTATATGCTGCTGTTGGTAATAAGTCTCAGGAGACCTGGAACGTCACCTCGCCATGATCACCTGGGAAAATGACTGCCTTTCTTACGGCCAAAACAGTCCTGCTGGACCTCTGCCCTGGACCTTTGGCACTCTGGACTAGTTCTGCTCTCTCTCGTGTACAATAAATCCTCTTGTTCTCAGCTAAAGAATCAAACAAAAG

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT099695.1

Data Sources

Source NameOld Id
gencodeENSMUST00000168897.1
NONCODEv4NONMMUT026571
PMID235831TCONS_00012276
ensemblENSMUST00000168897
PMID26117828TCONS_00004686
PMID26117828PNCT_MMU013947