An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT026676.1

General info


NONCODE TRANSCRIPT IDNONMMUT026676.1
NONCODE Gene IDNONMMUG016534.2
Chromosomechr16
Start Site43184572
End Site43185728
Strand+
Exon Number1
CNCI Score-0.0692224
Length1156
Assemblymm10
Other transcript VersionsNONMMUT026676.1(old version)

Sequence


>NONMMUT026676.1
GTGGTGTCTCAGCAATAATTCTCTGCTCCCAGGCATGAGTCCTTGGCTTCTTACCTCAAAAGCATAGTAGTCTTCACGGTGGGAAAGTGAAGACCTTCCCCAGGGATGACCCTTCCAAGCCTTTCCACCTCACATCGTTGCTAGTCTGCAAAGCTGGCATGACCCACATCATCAGTGAAGTGGACAGGCAGGATCCAAGGTGATCAAAAAGAAGTTGTGTAAGGTGTAACCATTGCTGAGACACCACCAATGCTGGCTGTGGGCATTGTGAGACAGGTGGAAATCCTTTGTAGGCCCTCTGCACCTTCAAGACTGTCTTTCCCTCACACATCAGTGACAAGTATAAAAGGTATTTCTACAAAAACACAGAAATGTAAAGAGAAGGCCTTCACCAATACTGCAAGAAATGGCAAGACAGCATAGGCAAGAGACCACTGTAGGAGGACTTCAATAACACAAAGAATCACTGCCAAGGCATCCACATTAGTTGCCACCAACAGATATGTGTGCTCCCTCTGCTCCAGAAGAAGGTCAGCTTAATGGAGATGCCAGCTGAGTATGTCACAGAGGCTGAGAAACTACACTGGGCCCTAGGGAGACTGTAAGAGAAAGATGAGATGATATCATCAGGGTGACCAAAGGAAATGCTACAAAGAGGACTCTAATTGCTGGCCTGAAAAGAAGCTACTCTGTAAAACCCACCTAGGGTTATCCAAGTTTTCTTGTATTAGAGCCTGGCACCCTCCCTGTGTGACCTTCTCTGTAGCTTGAGCCAGCCAAAAGGACTATCATCTTAAAAATCTATAAGATTTATCAGGGGTAGCTTATCAAGGGTGGCAAGCTGATCAAGAACAATGTTTCTGCATGTTCAAATATGATCTATCTTACTAGAGCCTCAACTTACTCGGGGGCATTGTCAGTTATGTTGAAATGACCAGTGACTTTGTGCTGCTGAATGGCTGTGTGGTAGGAACCAAGAGGCAAAGGTTTCTGCAAAACCCTGCTGGTATAAACCAAATGATGAGCTCTGGAGGAAACACATGAACTTATTTGACGCCATCTCAGGATTATTGATGGTCATTTCCAGACCACATAAGAGAAGACAGCATTCATGGGACCACCCAAGAAAGACCAGATTGTCAATGAAGAAGGTGCT

Expression Profile(Data Source:ERP000591)


NA

Data Sources


Source NameOld Id
NONCODEv4NONMMUT026676
ensemblENSMUST00000120369