An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT026940.1

General info


NONCODE TRANSCRIPT IDNONMMUT026940.1
NONCODE Gene IDNONMMUG016705.2
Chromosomechr16
Start Site53983934
End Site53985355
Strand-
Exon Number2
CNCI Score-0.0126976
Length1224
Assemblymm10
Other transcript VersionsNONMMUT026940.1(old version)

Sequence


>NONMMUT026940.1
GGTGAGAATTCCTGCCTTGGTGATGGAGATGGTCTGCTGCTCCATAACCTCATGGATGGCTGTGCGGTCAGCCTCGGCCATCTTGTCAAACTCATCAATACAGCACACACCCTGGTCAGCCAGCACCAGGGCACCACCCTCTAAAGTCAGTTCTCCACTCACAGAGTCTCTCAACACAGCTGCTGTGAGCCCTACACCAGAGGAGCCACGGCCTGTTGTGTACTGACTTCGGGGTGCCAGACGGTCAATGTAAGATAGGAGCTGAGATTTGGCCACACCAGGGTCTCCCATAAGGCAGATGTGGATGTTTCCTCTGATCTTCATGCCTTAAGGAGACTGGTCCACACCACCCACCAGAAGCAGCAGCAGTGCTTTCCTTACATCTTCATGTTCATAGATCTCCGGAGCAATAGAAGCAGCCAGCTTCTCATAGAAATCCTCCTCTGCAATCTGCTTCAGCTCCTCTGAGCTCAGCTCTCCGGCCCCAGAGACATCATATTCACTCTTTGTTATCTTCACAATCCAGTGGGCTTCCAGGTAAGTTTCTGAGAGTAAGCCCTGTGCCATCTGTTGGAATCCTGTGCGCAGGACTGGCAAGAAGATGCCAGTGACGCTGACATGGTCACCAGGCTGGGCAATTCTTGTGTTCTCACCTTCTAGAACCACTGTGATGCTCCGAGGAATGTTTCCCACAGGAACTTGGTCACTATGTTCTTGAATCTTCATTTCCTGGAATTTAACAAATTTGGAGCCACGAGTCTGTAGAGTCAGCTCGTACTTCCCGGATCACTCGAGGCTTGCTGCTACTTGGGCTTCAGAAATACAACTCAAATCTTCGCATGAGTTCAGAAGAATACTGGTTTTGGGGGTTCCGGACTGCCCCAGGGTCTCTGCTTCGCTGCTCCATCATCAGCCGGTGTTCAATGTAAACATCTAGGACATCCTTATTCACCACCTCCTTCTCCTTGTACTCAGGCAAAAGCTCTTGCACAACATCACCAAACAGTCTTGAGTAGCGCTTGGCATTCTCGCAAATTGAGTCGACCAACTCAGGGTCATCTTCAGCTATGTCATCCAGGTCCACATACAGTGCCACTTGTTCCCGATAAGCCAGATGAACCAACTGGGTCCCATACTTGAACTGCTTCTTTCCAAGCTCATTCTCGTAATAAAACTCTTGGAGGAACTTCTTAACTTTTTCTTTTTTGATCGCGGAGTCCTTAA

Expression Profile(Data Source:ERP000591)


NA

Data Sources


Source NameOld Id
NONCODEv4NONMMUT026940
PMID26117828TCONS_00005005
PMID26117828PNCT_MMU014095