An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT026940.1

General info


NONCODE TRANSCRIPT IDNONMMUT026940.1
NONCODE Gene IDNONMMUG016705.1
Chromosomechr16
Start Site53984047
End Site53985468
Strand-
Exon Number2
CNCI Score-0.0316255
Length1224
Assemblymm9
Other transcript VersionsNONMMUT026940.2

Sequence


>NONMMUT026940.1
GGTGAGAATTCCTGCCTTGGTGATGGAGATGGTCTGCTGCTCCATAACCTCATGGATGGCTGTGCGGTCAGCCTCGGCCATCTTGTCAAACTCATCAATACAGCACACACCCTGGTCAGCCAGCACCAGGGCACCACCCTCTAAAGTCAGTTCTCCACTCACAGAGTCTCTCAACACAGCTGCTGTGAGCCCTACACCAGAGGAGCCACGGCCTGTTGTGTACTGACTTCGGGGTGCCAGACGGTCAATGTAAGATAGGAGCTGAGATTTGGCCACACCAGGGTCTCCCATAAGGCAGATGTGGATGTTTCCTCTGATCTTCATGCCTTAAGGAGACTGGTCCACACCACCCACCAGAAGCAGCAGCAGTGCTTTCCTTACATCTTCATGTTCATAGATCTCCGGAGCAATAGAAGCAGCCAGCTTCTCATAGAAATCCTCCTCTGCAATCTGCTTCAGCTCCTCTGAGCTCAGCTCTCCGGCCCCAGAGACATCATATTCACTCTTTGTTATCTTCACAATCCAGTGGGCTTCCAGGTAAGTTTCTGAGAGTAAGCCCTGTGCCATCTGTTGGAATCCTGTGCGCAGGACTGGCAAGAAGATGCCAGTGACGCTGACATGGTCACCAGGCTGGGCAATTCTTGTGTTCTCACCTTCTAGAACCACTGTGATGCTCCGAGGAATGTTTCCCACAGGAACTTGGTCACTATGTTCTTGAATCTTCATTTCCTGGAATTTAACAAATTTGGAGCCACGAGTCTGTAGAGTCAGCTCGTACTTCCCGGATCACTCGAGGCTTGCTGCTACTTGGGCTTCAGAAATACAACTCAAATCTTCGCATGAGTTCAGAAGAATACTGGTTTTGGGGGTTCCGGACTGCCCCAGGGTCTCTGCTTCGCTGCTCCATCATCAGCCGGTGTTCAATGTAAACATCTAGGACATCCTTATTCACCACCTCCTTCTCCTTGTACTCAGGCAAAAGCTCTTGCACAACATCACCAAACAGTCTTGAGTAGCGCTTGGCATTCTCGCAAATTGAGTCGACCAACTCAGGGTCATCTTCAGCTATGTCATCCAGGTCCACATACAGTGCCACTTGTTCCCGATAAGCCAGATGAACCAACTGGGTCCCATACTTGAACTGCTTCTTTCCAAGCTCATTCTCGTAATAAAACTCTTGGAGGAACTTCTTAACTTTTTCTTTTTTGATCGCGGAGTCCTTAA

Expression Profile


NA

Data Sources


Source NameOld Id
NONCODEv4NONMMUT026940
PMID26117828TCONS_00005005
PMID26117828PNCT_MMU014095