An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT032431.1

General info


NONCODE TRANSCRIPT IDNONMMUT032431.1
NONCODE Gene IDNONMMUG019976.2
Chromosomechr18
Start Site56502552
End Site56518587
Strand-
Exon Number2
CNCI Score-0.0401408
Length524
Assemblymm10
Other transcript VersionsNONMMUT032431.1(old version)

Sequence


>NONMMUT032431.1
GTGTGCTTCAAATTAGTCTCTGCAGGCTTCCAGTTATACTTGAAAACTTCGCAGAGCACCAACTTGTTGGGGTCTTTGTGGAAGGGGTCTTGAAACATGGCAACAGGGCGGAGATACCATGTCACTGTTGGAGCCTTCAGACTGAAAGGTAGTAGAGCCATCAAAGTTCCACTCAGGTGTCTTCCGGGACCTTGCTCACCTCCCGAGATGGGTCTGTTATCTTCAGGCAGCAGCAGCAGAGACAAGGCCAACTTTTATTGCACAAAAGCAAACTCATTCCCTTTTCCCCACCCCCTTTCCTAAGCTGGAGACCTCCAAAGGGCAAACACATCTGGATTCTCAGCGTCTCGCGCCTCTGGCCAGCAGGGGGCGCACAACAGACTCTCAAGAAGCACCGTCTTCAAGGGAGAACGTGAGGTATTTATGTTGGTCCCAGCAGCTGGTCACTCAGTCACCATTCTCAAGCAGCTTTTGTAAGTTGTTTTGTATCTTGAAACAATAAAAAAAGATGGCGTTATTATAAG

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID
NONMMUT104625.1

Data Sources

Source NameOld Id
PMID26117828PNCT_MMU017078
PMID26117828TCONS_00005914
NONCODEv4NONMMUT032431