An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT032806.1

General info


NONCODE TRANSCRIPT IDNONMMUT032806.1
NONCODE Gene IDNONMMUG020178.2
Chromosomechr18
Start Site67401021
End Site67403008
Strand-
Exon Number1
CNCI Score-0.0573440
Length1987
Assemblymm10
Other transcript VersionsNONMMUT032806.1(old version)

Sequence


>NONMMUT032806.1
ACTAGAAGAATGACAAAAGTTTGCACCTGTGGGGATGTCAGTGGTACCCACCTCACCCTTGCCCTCTTCTGCACAGGGATGGGAATGGCAAGGTTTAGCCGTGTGGCAGGTAGCCAGTTGAAGCCTGACCCACACACAGCAGGCCCTACTCCAAACAGCTATTTCCTGGATAGATGTGATGTTCTGCTATCTCACCAAATAGATACCTGAAAAATGAGACCACATGACAGTGCTTTGATGAAGTTCAAGAGACCGATGATCAGGTTTAGCATTTTATTATGAATGGATTGTCATAAAGTTCCATAGTGTGCATTCACTTAAGGCAGCACTGTGTGGCTTTAGTTTTTATCACCGAGGATGAAAAACAAATCCCTATTCTAACTCTGATGGGGTGGGAAGGGGGCTTAACAAAAGGTGGTCACTTTCTTTAGCCCTGTGTGAGCCCCCTACTTTGCTTTCAGGGTTCCTATATGAGATCTCCCTGGTCTGCTGGGACTGTTCCAGGTAACCTGGAGAACAGTGTGGTGCATTTGGTTTGAGAGGGGCCAGTGACATGCTTAGACCAGGGCACCATTCCCACACCATCAAGGCTAAGAAAAGAGCAGACGTTCACTGTAGCATCTTATGGCTCCCTATTCGTTGATCTCTTCTTCATCCTCGTCTTCAAATGCCTCTTCCCCATCATTGACCGTGGCGTCCTGGTACTGCTGGTACTCGGACACCAGGTCATTCATGTTACTCTCGGCCTCGGTGAACTCCATCTCGTCCATGCCCTCACCGGTGAACCAGTGCAGGAAGGCCTTGCGGCGGAACATGGCCGAGAACTGCTCGGAGATGCGCTTGAATAGCTCCTGGATGGCAGTGCTATTGCCAATGAAGGTGGAGGCCATCTTCAGGCCCCGTGGTGGGATGTCGCACACAGCTACCTTGACATTGTTGGGGATCCACTCCACAAAGTAGCTGCTGTTCTTGTTCTGGATGGCCAGCATCTGCTCGTCCACCTCCTTCATGGACATGGGGCCCCGGAAGACAGTGGCGACGGTCAGGTAGCGGCCATGGCGTGGGTCACAGGCAGCCATCATGTTCTTGGCATCGAACATCTGCTGTGTGAGCTCAGGCACTGTCAGGGCACGGTACTGCTGACTGCCCCGGGCTGTGAGGGGGGCAAAGCCGGGCATGAAGAAGTGGAGACGTGGGAATGGCACCATGTTCACAGCCAGCTTGCGCAGGTCGGCGTTGAGTTGGCCAGGGAAACGCAGTGATGTGGTGACACCGCTCATGGTGGCGGATACCAAGTGGTTGAGGTCCCCGTAAGTGGGTGTGGTCAGCTTGAGCGTGCGGAAGCAGATGTCATAGAGGGCCTCGTTGTCGATGCAGTAGGTCTCGTCGGTGTTCTCTACCAGCTGGTGCACTGACAATGTGGCGTTGTAGGGCTCCACCACGGTGTCTGAGACCTTGGGTGACGGCATGACGCTGAAGGTGTTCATGATGCGGTCCGGGTACTCCTCTCGGATCTTGCTGATGAGCAGTGTGCCCATGCCTGAGCCCGTGCCACCGCCCAGCGAGTGGGTGAGCTGGAAGCCCTGAAGACAGTCGCAATGCTCACACTCCTTGCGCACCACATCCAGCACCGAATCCACCAGCTCCGCGCCCTCCGTGTAGTGACCCTTGGCCCAGTTGTTTCCGGCACCCGTCTGTCCTGCAAGGCAGCAAAATTCCAAAGGGAATATCAGTGACCTGCTTTCTCCCATCAGTATTTTTTTTTTCAGTGAAAGAGACCCGGAGCAAAGGACCAGGAACCAGGCTGTAACAGGTACCCATCACGGTGCCTAGAAGGCAGGTGAGCAAGCACTTCTTCAGACAGGCCAACTATACATCCAGGGACCGGGGTCCTGTTCATTAAAAGAGTACACTTTATACTCTGAGGCCCTGATTCACCTGGAATCAACCTTAGGGCATTATATTAAACAATATAAAAATTTAAGAT

Expression Profile(Data Source:ERP000591)


NA

Data Sources


Source NameOld Id
noncodeV3n281071
NONCODEv4NONMMUT032806