An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037903.1

General info


NONCODE TRANSCRIPT IDNONMMUT037903.1
NONCODE Gene IDNONMMUG023408.2
Chromosomechr2
Start Site73315454
End Site73318556
Strand+
Exon Number2
CNCI Score-0.1679360
Length449
Assemblymm10
Other transcript VersionsNONMMUT037903.1(old version)

Sequence


>NONMMUT037903.1
ACTTTTGTGGCATTACCTCCAGCAACAGTAGGAAATAGGGTTATTTTTGGAAAAAATTCAGACAGACTCTTTGATGAAGTACAAGAAGTAATTTACTGTCCAGCTGCAGTTCATAATGATTTGGAAAAACGTCTCAAGTGTACTTATATAGAAGTTGATCAAGTTCCTGAAACATATGCTGTTGTCCTTAGTCGCCCAGCTTGGCTGTGGGGGGCAGAAATGGGTGCCAATGAGCATGGAGTCTGCATTGGGAATGAGGCTGTATGGGGAAGAGAAGACATTTCTAAGGAGGAAGCACTTTTGGGCATGGACCTTGTCAGGTAACAGTTGTGCTGCTTTCCCACTGTAGATGATGTGGGAAATGGTAAATACCAACCCACATCCATTTTCACTCACTGATGTCACTAATTAGTCCAAGCGCATGGCTCAGTCCACATAGTCCTCACTCC

Expression Profile(Data Source:ERP000591)


NA

Data Sources


Source NameOld Id
noncodeV3n295815
NONCODEv4NONMMUT037903