An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037903.1

General info


NONCODE TRANSCRIPT IDNONMMUT037903.1
NONCODE Gene IDNONMMUG023408.1
Chromosomechr2
Start Site73153511
End Site73156613
Strand+
Exon Number2
CNCI Score-0.1423748
Length449
Assemblymm9
Other transcript VersionsNONMMUT037903.2

Sequence


>NONMMUT037903.1
ACTTTTGTGGCATTACCTCCAGCAACAGTAGGAAATAGGGTTATTTTTGGAAAAAATTCAGACAGACTCTTTGATGAAGTACAAGAAGTAATTTACTGTCCAGCTGCAGTTCATAATGATTTGGAAAAACGTCTCAAGTGTACTTATATAGAAGTTGATCAAGTTCCTGAAACATATGCTGTTGTCCTTAGTCGCCCAGCTTGGCTGTGGGGGGCAGAAATGGGTGCCAATGAGCATGGAGTCTGCATTGGGAATGAGGCTGTATGGGGAAGAGAAGACATTTCTAAGGAGGAAGCACTTTTGGGCATGGACCTTGTCAGGTAACAGTTGTGCTGCTTTCCCACTGTAGATGATGTGGGAAATGGTAAATACCAACCCACATCCATTTTCACTCACTGATGTCACTAATTAGTCCAAGCGCATGGCTCAGTCCACATAGTCCTCACTCC

Expression Profile


NA

Isoforms


Transcript ID
NONMMUT037902.1

Data Sources


Source NameOld Id
noncodeV3n295815
NONCODEv4NONMMUT037903