An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037974.1

General info


NONCODE TRANSCRIPT IDNONMMUT037974.1
NONCODE Gene IDNONMMUG023448.2
Chromosomechr2
Start Site74683445
End Site74694194
Strand+
Exon Number3
CNCI Score-0.0253952
Length623
Assemblymm10
Other transcript VersionsNONMMUT037974.1(old version)

Sequence


>NONMMUT037974.1
GGAAGTACATTTGCAGCCAGTTGATGAGTGGGAACACGAGAGCCTCCTGCCTTTCAGGGAGAGGTGGCCCCCCAGAGGTCCCGGAAAAAGCGCTGTCCCTACACCAAGTACCAGATCCGCGAACTGGAACGCGAGTTTTTCTTTAATGTATACATAAACAAAGAGAAAAGACTCCAACTCTCTCGGATGCTCAACCTCACTGACCGGCAAGTCAAAATCTGGTTCCAGAATCGCAGGATGAAAGAAAAGAAACTGAACAGGGACCGTCTGCAATATTTCACTGGAAACCCCTTATTTTGAGAACTCCAGGATGTACCCCCTCCCCAGAGCCCCACTCACCCACCCTCCTCCCCACCAGCCTGCTCTCAGCAGGCCCAATGTCCTTGGGTTCAATGACGCCTCTTCTCTGTGGAACTTCACGATTTCTTCTCGCCTTCAACTCGGGACCTCCCAGCGACCACTACAGCCTGAGGAAGAGGCCCGGAACTTGGCTGTGCGGATCCTAATAAGGGGAACATGAGGAAATCAAGTCTGATACTCCAACCAGCAATTGGCTCACTGCAAAGAGTGGCAGAAAGAAGAGGTGCCCTTACACCAAGCACCAAACGCTGGAATTGGAAAAA

Expression Profile(Data Source:ERP000591)

NA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_MMU019902
NONCODEv4NONMMUT037974
ensemblENSMUST00000136302
PMID26117828TCONS_00006447
gencodeENSMUST00000136302.2