An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT037974.1

General info


NONCODE TRANSCRIPT IDNONMMUT037974.1
NONCODE Gene IDNONMMUG023448.1
Chromosomechr2
Start Site74521502
End Site74532251
Strand+
Exon Number3
CNCI Score-0.0626186
Length623
Assemblymm9
Other transcript VersionsNONMMUT037974.2

Sequence


>NONMMUT037974.1
GGAAGTACATTTGCAGCCAGTTGATGAGTGGGAACACGAGAGCCTCCTGCCTTTCAGGGAGAGGTGGCCCCCCAGAGGTCCCGGAAAAAGCGCTGTCCCTACACCAAGTACCAGATCCGCGAACTGGAACGCGAGTTTTTCTTTAATGTATACATAAACAAAGAGAAAAGACTCCAACTCTCTCGGATGCTCAACCTCACTGACCGGCAAGTCAAAATCTGGTTCCAGAATCGCAGGATGAAAGAAAAGAAACTGAACAGGGACCGTCTGCAATATTTCACTGGAAACCCCTTATTTTGAGAACTCCAGGATGTACCCCCTCCCCAGAGCCCCACTCACCCACCCTCCTCCCCACCAGCCTGCTCTCAGCAGGCCCAATGTCCTTGGGTTCAATGACGCCTCTTCTCTGTGGAACTTCACGATTTCTTCTCGCCTTCAACTCGGGACCTCCCAGCGACCACTACAGCCTGAGGAAGAGGCCCGGAACTTGGCTGTGCGGATCCTAATAAGGGGAACATGAGGAAATCAAGTCTGATACTCCAACCAGCAATTGGCTCACTGCAAAGAGTGGCAGAAAGAAGAGGTGCCCTTACACCAAGCACCAAACGCTGGAATTGGAAAAA

Expression Profile


NA

Isoforms


Transcript ID
NONMMUT037972.1
NONMMUT037975.1

Data Sources


Source NameOld Id
PMID26117828PNCT_MMU019902
NONCODEv4NONMMUT037974
ensemblENSMUST00000136302
PMID26117828TCONS_00006447
gencodeENSMUST00000136302.2